pCZGY921
(Plasmid
#135092)
-
PurposeTranscriptional GFP reporter of acr-2 (cholinergic) expressing neurons in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDEST
-
Backbone manufacturerInvitrogen Gateway
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6641
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePacr-2
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1888
- Promoter Pacr-2
-
Tags
/ Fusion Proteins
- Synthetic Intron (C terminal on insert)
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tgtaaaacgacggccagt
- 3′ sequencing primer CCAAGGGTCCTCCTGAAAATGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY921 was a gift from Yishi Jin (Addgene plasmid # 135092 ; http://n2t.net/addgene:135092 ; RRID:Addgene_135092) -
For your References section:
A neuronal acetylcholine receptor regulates the balance of muscle excitation and inhibition in Caenorhabditis elegans. Jospin M, Qi YB, Stawicki TM, Boulin T, Schuske KR, Horvitz HR, Bessereau JL, Jorgensen EM, Jin Y. PLoS Biol. 2009 Dec;7(12):e1000265. doi: 10.1371/journal.pbio.1000265. Epub 2009 Dec 22. 10.1371/journal.pbio.1000265 PubMed 20027209