Skip to main content

pCZGY2750
(Plasmid #135094)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135094 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDD162
  • Backbone manufacturer
    Goldstein Lab
  • Backbone size w/o insert (bp) 8113
  • Total vector size (bp) 8133
  • Modifications to backbone
    Insertion of sgRNA sequence specific to a region of Chromosome IV devoid of known coding regions. Cloning was performed using site-directed mutagenesis with the sgRNA being inserted behind the U6 promoter.
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA for cxTi10082 (actgttggatgcctgtgtag)
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer aaggcgcacactctgttttg
  • 3′ sequencing primer ggtgtgaaataccgcacaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY2750 was a gift from Yishi Jin (Addgene plasmid # 135094 ; http://n2t.net/addgene:135094 ; RRID:Addgene_135094)
  • For your References section:

    Inhibition of Axon Regeneration by Liquid-like TIAR-2 Granules. Andrusiak MG, Sharifnia P, Lyu X, Wang Z, Dickey AM, Wu Z, Chisholm AD, Jin Y. Neuron. 2019 Jul 24. pii: S0896-6273(19)30602-6. doi: 10.1016/j.neuron.2019.07.004. 10.1016/j.neuron.2019.07.004 PubMed 31378567