pCZGY2750
(Plasmid
#135094)
-
PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IV
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDD162
-
Backbone manufacturerGoldstein Lab
- Backbone size w/o insert (bp) 8113
- Total vector size (bp) 8133
-
Modifications to backboneInsertion of sgRNA sequence specific to a region of Chromosome IV devoid of known coding regions. Cloning was performed using site-directed mutagenesis with the sgRNA being inserted behind the U6 promoter.
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA for cxTi10082 (actgttggatgcctgtgtag)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer aaggcgcacactctgttttg
- 3′ sequencing primer ggtgtgaaataccgcacaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY2750 was a gift from Yishi Jin (Addgene plasmid # 135094 ; http://n2t.net/addgene:135094 ; RRID:Addgene_135094) -
For your References section:
Inhibition of Axon Regeneration by Liquid-like TIAR-2 Granules. Andrusiak MG, Sharifnia P, Lyu X, Wang Z, Dickey AM, Wu Z, Chisholm AD, Jin Y. Neuron. 2019 Jul 24. pii: S0896-6273(19)30602-6. doi: 10.1016/j.neuron.2019.07.004. 10.1016/j.neuron.2019.07.004 PubMed 31378567