RBM15B_3xRRM_pGEX
(Plasmid
#135125)
-
PurposeRecombinant expression of RBM15B with dual-affinity tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-6P-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5081
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRBM15B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)543
-
Entrez GeneRBM15B (a.k.a. HUMAGCGB, OTT3)
- Promoter tac
-
Tag
/ Fusion Protein
- GST-SBP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer 5GEX (GGGCTGGCAAGCCACGTTTGGTG)
- 3′ sequencing primer 3GEX (CCGGGAGCTGCATGTGTCAGAGG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RBM15B_3xRRM_pGEX was a gift from Christopher Burge (Addgene plasmid # 135125 ; http://n2t.net/addgene:135125 ; RRID:Addgene_135125) -
For your References section:
Sequence, Structure, and Context Preferences of Human RNA Binding Proteins. Dominguez D, Freese P, Alexis MS, Su A, Hochman M, Palden T, Bazile C, Lambert NJ, Van Nostrand EL, Pratt GA, Yeo GW, Graveley BR, Burge CB. Mol Cell. 2018 Jun 7;70(5):854-867.e9. doi: 10.1016/j.molcel.2018.05.001. Epub 2018 Jun 7. 10.1016/j.molcel.2018.05.001 PubMed 29883606