Skip to main content

KHDRBS3_KH_pGEX
(Plasmid #135133)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135133 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-6P-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5081
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KHDRBS3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    663
  • Entrez Gene
    KHDRBS3 (a.k.a. Etle, SALP, SLM-2, SLM2, T-STAR, TSTAR, etoile)
  • Promoter tac
  • Tag / Fusion Protein
    • GST-SBP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer 5GEX (GGGCTGGCAAGCCACGTTTGGTG)
  • 3′ sequencing primer 3GEX (CCGGGAGCTGCATGTGTCAGAGG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KHDRBS3_KH_pGEX was a gift from Christopher Burge (Addgene plasmid # 135133 ; http://n2t.net/addgene:135133 ; RRID:Addgene_135133)
  • For your References section:

    Sequence, Structure, and Context Preferences of Human RNA Binding Proteins. Dominguez D, Freese P, Alexis MS, Su A, Hochman M, Palden T, Bazile C, Lambert NJ, Van Nostrand EL, Pratt GA, Yeo GW, Graveley BR, Burge CB. Mol Cell. 2018 Jun 7;70(5):854-867.e9. doi: 10.1016/j.molcel.2018.05.001. Epub 2018 Jun 7. 10.1016/j.molcel.2018.05.001 PubMed 29883606