pSB1C3-pT7-sfGFP_RED20
(Plasmid
#135173)
-
PurposeExpresses sfGFP recoded in the RED20 genetic code off the T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1C3
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 2700
-
Modifications to backboneAdded T7 promoter upstream of GOI
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfGFP_RED20
-
Alt namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
-
MutationRecoded ORF of sfGFP to only use one codon per amino acid
-
GenBank IDMN315260
- Promoter taatacgactcactata
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACCTGACGTCTAAGAAAC
- 3′ sequencing primer GTATTACCGCCTTTGAGTGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1C3-pT7-sfGFP_RED20 was a gift from Drew Endy (Addgene plasmid # 135173 ; http://n2t.net/addgene:135173 ; RRID:Addgene_135173) -
For your References section:
Fail-safe genetic codes designed to intrinsically contain engineered organisms. Calles J, Justice I, Brinkley D, Garcia A, Endy D. Nucleic Acids Res. 2019 Sep 12. pii: 5568210. doi: 10.1093/nar/gkz745. 10.1093/nar/gkz745 PubMed 31511890