- 
            PurposeExpresses an mCherry-SopF fusion in mammalian cells
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepmCherry-C1
 - 
              Backbone manufacturerClontech
 - Backbone size w/o insert (bp) 4722
 - Total vector size (bp) 5844
 - 
              Vector typeMammalian Expression
 - 
                Selectable markersNeomycin (select with G418)
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameSopF
 - 
                    SpeciesSalmonella enterica serovar Typhimurium
 - 
                  Insert Size (bp)1125
 - 
                        Entrez GeneSTM1239 (a.k.a. STM1239)
 - 
    
        Tag
        / Fusion Protein
    
- mCherry (N terminal on backbone)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site EcoRI (unknown if destroyed)
 - 3′ cloning site SalI (unknown if destroyed)
 - 5′ sequencing primer pmCherryC1-F (5' GTTGGACATCACCTCCCACAACGAG 3') (Common Sequencing Primers)
 
Resource Information
- 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pmCherry-SopF was a gift from Leigh Knodler (Addgene plasmid # 135174 ; http://n2t.net/addgene:135174 ; RRID:Addgene_135174) - 
                
For your References section:
SopF, a phosphoinositide binding effector, promotes the stability of the nascent Salmonella-containing vacuole. Lau N, Haeberle AL, O'Keeffe BJ, Latomanski EA, Celli J, Newton HJ, Knodler LA. PLoS Pathog. 2019 Jul 24;15(7):e1007959. doi: 10.1371/journal.ppat.1007959. eCollection 2019 Jul. 10.1371/journal.ppat.1007959 PubMed 31339948