pBIP1::eYFP
(Plasmid #135231)

• Purpose: UPR signaling reporter (upregulates eYFP expression under UPR conditions)
• Depositing Lab: Armin Djamei
• Publication: Alcantara et al Plant Methods. 2020 Jan 21;16:4. doi: 10.1186/s13007-020-0552-3. eCollection 2020.

Backbone

• Vector backbone: pGGZ001
• Backbone manufacturer: Addgene plasmid # 48868
• Backbone size w/o insert (bp): 2687
• Total vector size (bp): 6975
• Modifications to backbone: N/A
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pBiP1
• Alt name: BiP1 promoter
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1198
• Promoter: BiP1
• Tag / Fusion Protein:
  • eYFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: TAGGCTCGGACGAAGTAAGC
• 3′ sequencing primer: ATACAAGGCCCCAAAACACA

Resource Information

• Supplemental Documents:
  • Plasmid 135231 pBIP1-eYFP

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/825190v1?rss=1 for bioRxiv preprint.

Please see the attached genbank file for an BIP1 annotated plasmid map.