Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p35S::HY5
(Plasmid #135233)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGGZ001
  • Backbone manufacturer
    Addgene plasmid # 48868
  • Backbone size w/o insert (bp) 2687
  • Total vector size (bp) 6435
  • Modifications to backbone
    N/A
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HY5
  • Alt name
    AT5G11260
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    517
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer TCAAAGCAAGTGGATTGATG
  • 3′ sequencing primer GAAAGAGATAACAGGAACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/825190v1?rss=1 for bioRxiv preprint.

Please see the attached genbank file for an HY5 annotated plasmid map.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p35S::HY5 was a gift from Armin Djamei (Addgene plasmid # 135233 ; http://n2t.net/addgene:135233 ; RRID:Addgene_135233)
  • For your References section:

    A high-throughput screening method to identify proteins involved in unfolded protein response of the endoplasmic reticulum in plants. Alcantara A, Seitner D, Navarrete F, Djamei A. Plant Methods. 2020 Jan 21;16:4. doi: 10.1186/s13007-020-0552-3. eCollection 2020. 10.1186/s13007-020-0552-3 PubMed 31988651