pcDNA3.1-hRARα.hRXRα
(Plasmid
#135411)
-
PurposeHuman Retinoic Acid Receptor-alpha and Human Retinoid X Receptor-alpha in pcDNA3.1(+) plasmid expression vector
-
Depositing Lab
-
Depositing OrganizationPennsylvania State University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 135411-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 135411-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 8206
-
Modifications to backboneNeomycin gene was removed and replaced with RXRα at the sites of SmaI/BstBI.
-
Vector typeMammalian Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHuman retinoic acid receptor-alpha
-
Alt nameRARα
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1389
-
GenBank IDNM_000964
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCTAGCGCCACCATGGCCAGCAACAGCAGC
- 3′ sequencing primer TTAAGCTTCACGGGGAGTGGGTGGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman retinoid X receptor-alpha
-
Alt nameRXRα
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1389
-
GenBank IDNM_002957
- Promoter SV40
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer GCCACCATGGACACCAAACATTTCCTG
- 3′ sequencing primer TATTCGAACTAAGTCATTTGGTGCGGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RARα was cloned in the multiple cloning site at NheI/HindIII. Neomycin gene was removed and replaced with RXRα at the sites of SmaI/BstBI.
DNA (Catalog # 135411-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 135411-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-hRARα.hRXRα was a gift from Catharine Ross (Addgene plasmid # 135411 ; http://n2t.net/addgene:135411 ; RRID:Addgene_135411) -
For your References section:
CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331