pcDNA3.1-hRARβ.hRXRα
(Plasmid
#135415)
-
PurposeHuman Retinoic Acid Receptor-beta and Human Retinoid X Receptor-alpha in pcDNA3.1(+) plasmid expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1(+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 8185
-
Modifications to backboneNeomycin gene was removed and replaced with RXRα at the sites of SmaI/BstBI.
-
Vector typeMammalian Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHuman retinoic acid receptor-beta
-
Alt nameRARβ
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1368
-
GenBank IDNM_001290216
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCTAGCGCCACCATGACCACCAGCGGCCACG
- 3′ sequencing primer TTAAGCTTATTGCACGAGTGGTGACTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHuman retinoid X receptor-alpha
-
Alt nameRXRα
-
Insert Size (bp)1389
-
GenBank IDNM_002957
- Promoter SV40
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site BstB1 (not destroyed)
- 5′ sequencing primer GCCACCATGGACACCAAACATTTCCTG
- 3′ sequencing primer TATTCGAACTAAGTCATTTGGTGCGGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RARβ was cloned in the multiple cloning site at NheI/HindIII. Neomycin gene was removed and replaced with RXRα at the sites of SmaI/BstBI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-hRARβ.hRXRα was a gift from Catharine Ross (Addgene plasmid # 135415 ; http://n2t.net/addgene:135415 ; RRID:Addgene_135415) -
For your References section:
CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331