pGL3-Basic-hCYP26A1P-E4-mCherry
(Plasmid
#135478)
-
PurposeHuman short form promoter of human gene in pGL3-Basic-mCherry plasmid vector (Namely, E4.2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135478 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic-luciferase
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5842
-
Modifications to backboneThe mCherry ORF DNA fragment was amplified by PCR and subjected to TA cloning into the pGEM-T Easy vector. An isolated clone was sequenced for confirmation and then double digested with NcoI/XbaI for obtaining the mCherry fragment insert. For construction of pGL3-Basic-hCYP26A1P-mCherry (E4.2) clone containing the human CYP26A1 promoter, the pGL3-Basic-hCYP26A1P-E4 Luciferase was first double digested with NcoI/XbaI to remove luciferase DNA fragment and then replaced with mCherry.
-
Vector typeUnspecified
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry Open reading Frame
-
Alt nameRed Fluorescent Protein
-
Insert Size (bp)713
- Promoter Short from promoter of human CYP26A1 (312 bp)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer AACCATGGTGAGCAAGGGCGAGG
- 3′ sequencing primer AATCTAGATTACTTGTACAGCTCGTCCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Basic-hCYP26A1P-E4-mCherry was a gift from Catharine Ross (Addgene plasmid # 135478 ; http://n2t.net/addgene:135478 ; RRID:Addgene_135478) -
For your References section:
CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331