pGL3-Basic-hCYP26A1P-E4-luciferase
(Plasmid
#135592)
-
PurposeShort form DNA fragment of human CYP26A1gene promoter (E4) in pGL3-Basic-luc vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic-luciferase
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5130
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShort form promoter of human CYP26A1 gene (E4)
-
Alt namehCYP26A1P (E4)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)312
- Promoter Human CYP26A1 promoter (Short Form, E4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AGCAAGCTTGTACAGATAGATTAAAACGT
- 3′ sequencing primer AATAAGCTTCACGAAGGTGCAGAGCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Basic-hCYP26A1P-E4-luciferase was a gift from Catharine Ross (Addgene plasmid # 135592 ; http://n2t.net/addgene:135592 ; RRID:Addgene_135592) -
For your References section:
Multiple retinoic acid response elements cooperate to enhance the inducibility of CYP26A1 gene expression in liver. Zhang Y, Zolfaghari R, Ross AC. Gene. 2010 Sep 15;464(1-2):32-43. doi: 10.1016/j.gene.2010.05.004. Epub 2010 Jun 8. 10.1016/j.gene.2010.05.004 PubMed 20682464