Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGL3-Basic-hCYP26A1-FL- luciferase
(Plasmid #135566)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135566 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Basic-luciferase
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6968
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Follow the protocol from Promega.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Full-length promoter of human retinoic acid receptor-beta gene
  • Alt name
    CYP26A1P
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2150
  • Promoter hHuman CYP26A1 gene promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AGCAAGCTTGTACAGATAGATTAAAACGT
  • 3′ sequencing primer AATAAGCTTCACGAAGGTGCAGAGCGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PCR amplified full-length (FL) promoter of the human CYP26A1 gene was cloned from the FOSMID vector into HindIII site of the pGL3 Basic Luciferase reporter vector (see Zhang et. al, 2010, Gene 464: 32–43). An isolated clone was digested with AscI and AleI and then re-ligated to form pGL3-Basic-hCYP26A1-FL-luciferase clone containing the FL promoter covering from −2139 5’upstream to + 11 3’downstream position of the transcription start site in the gene. An isolated pGL3-Basic-hCYP26A1-FL-luciferase clone was submitted to sequencing for confirmation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Basic-hCYP26A1-FL- luciferase was a gift from Catharine Ross (Addgene plasmid # 135566 ; http://n2t.net/addgene:135566 ; RRID:Addgene_135566)
  • For your References section:

    Hepatocyte nuclear factor 4alpha (HNF4alpha) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. Zolfaghari R, Ross AC. J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839. 10.1002/jcb.24839 PubMed 24819304