pGL3-Basic-hCYP26A1-FL- luciferase
(Plasmid #135566)

• Purpose: Full Length promoter of the human CYP26A1 gene in pGL3-Basic-luciferase
• Depositing Lab: Catharine Ross
• Depositing Organization: Pennsylvania State University
  Located in United States of America
• Publication: Zolfaghari et al J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839.
• Citations: 1 Article

Backbone

• Vector backbone: pGL3-Basic-luciferase
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6968
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Follow the protocol from Promega.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Full-length promoter of human retinoic acid receptor-beta gene
• Alt name: CYP26A1P
• Species: H. sapiens (human)
• Insert Size (bp): 2150
• Promoter: hHuman CYP26A1 gene promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: AGCAAGCTTGTACAGATAGATTAAAACGT
• 3′ sequencing primer: AATAAGCTTCACGAAGGTGCAGAGCGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PCR amplified full-length (FL) promoter of the human CYP26A1 gene was cloned from the FOSMID vector into HindIII site of the pGL3 Basic Luciferase reporter vector (see Zhang et. al, 2010, Gene 464: 32–43). An isolated clone was digested with AscI and AleI and then re-ligated to form pGL3-Basic-hCYP26A1-FL-luciferase clone containing the FL promoter covering from −2139 5’upstream to + 11 3’downstream position of the transcription start site in the gene. An isolated pGL3-Basic-hCYP26A1-FL-luciferase clone was submitted to sequencing for confirmation.

DNA (Catalog # 135566-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 135566-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.