Skip to main content

pGL3-basic-hRARβP-FL-luciferase
(Plasmid #135447)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135447 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-Basic-luciferase
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6735

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Follow the protocol from Promega.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Full-length promoter of human retinoic acid receptor-beta gene
  • Alt name
    RARβ promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1917
  • GenBank ID
    NC_000003
  • Promoter Human RARβ promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (destroyed during cloning)
  • 3′ cloning site SacII (destroyed during cloning)
  • 5′ sequencing primer CCAATGCACATTCCAACACT
  • 3′ sequencing primer GATCCCAAGTTCTCCTTCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The PCR amplified DNA fragment including the full length RARβ promoter and partial 5′-UTR of the RARβ mRNA was cloned in pGEM-T Easy plasmid vector by TA cloning (Promega), double digested with NdeI/SacII, blunt-ended and then sub-cloned into the Sma-I site of the pGL3-Basic-Luciferase from Promega.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-basic-hRARβP-FL-luciferase was a gift from Catharine Ross (Addgene plasmid # 135447 ; http://n2t.net/addgene:135447 ; RRID:Addgene_135447)
  • For your References section:

    CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331