pFB HTB_hMSH6_T1219D
(Plasmid
#135466)
-
PurposeExpression human MSH6_T1219D mutant protein using baculovirus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastBac HTB
- Backbone size w/o insert (bp) 4857
- Total vector size (bp) 8876
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MSH6_T1219D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4083
-
Mutationchanged threonine to aspartic acid
-
GenBank IDBC004246
-
Entrez GeneMSH6 (a.k.a. GTBP, GTMBP, HNPCC5, HSAP, MMRCS3, MSH-6, p160)
-
Tag
/ Fusion Protein
- His-tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CCTATAAATATTCCGGATTATTCATACC
- 3′ sequencing primer GTGATGCTATTGCTTTATTTGTAACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB HTB_hMSH6_T1219D was a gift from Peggy Hsieh (Addgene plasmid # 135466 ; http://n2t.net/addgene:135466 ; RRID:Addgene_135466) -
For your References section:
In vitro studies of DNA mismatch repair proteins. Geng H, Du C, Chen S, Salerno V, Manfredi C, Hsieh P. Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15. 10.1016/j.ab.2011.02.017 PubMed 21329650