pGL3-Basic-hCYP26A1P-E4-mCherry
(Plasmid #135478)

• Purpose: Human short form promoter of human gene in pGL3-Basic-mCherry plasmid vector (Namely, E4.2)
• Depositing Lab: Catharine Ross
• Depositing Organization: Pennsylvania State University
  Located in the United States of America
• Publication: Zolfaghari et al Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27.

Backbone

• Vector backbone: pGL3-Basic-luciferase
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 5842
• Modifications to backbone: The mCherry ORF DNA fragment was amplified by PCR and subjected to TA cloning into the pGEM-T Easy vector. An isolated clone was sequenced for confirmation and then double digested with NcoI/XbaI for obtaining the mCherry fragment insert. For construction of pGL3-Basic-hCYP26A1P-mCherry (E4.2) clone containing the human CYP26A1 promoter, the pGL3-Basic-hCYP26A1P-E4 Luciferase was first double digested with NcoI/XbaI to remove luciferase DNA fragment and then replaced with mCherry.
• Vector type: Unspecified
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Follow the protocol from Promega.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry Open reading Frame
• Alt name: Red Fluorescent Protein
• Insert Size (bp): 713
• Promoter: Short from promoter of human CYP26A1 (312 bp)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AACCATGGTGAGCAAGGGCGAGG
• 3′ sequencing primer: AATCTAGATTACTTGTACAGCTCGTCCATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 135478-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 135478-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.