pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
(Plasmid
#135562)
-
PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135562 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepscAAV CMV-IE Nuc-EYFP
-
Backbone manufacturerNIDA OTTC
- Backbone size w/o insert (bp) 4300
-
Vector typeMammalian Expression, AAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameshRNA (mouse PKCd)
-
Alt namemouse PKCd
-
SpeciesM. musculus (mouse), R. norvegicus (rat)
-
Insert Size (bp)-1
- Promoter mU6
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCtCGCACAGACTTGTGGGA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNuc-EYFP
-
Alt nameYellow Fluorescent protein
-
Insert Size (bp)800
- Promoter CMV-IE
-
Tag
/ Fusion Protein
- 3xNLS (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP was a gift from Christopher Richie (Addgene plasmid # 135562 ; http://n2t.net/addgene:135562 ; RRID:Addgene_135562) -
For your References section:
Abstinence-dependent dissociable central amygdala microcircuits control drug craving. Venniro M, Russell TI, Ramsey LA, Richie CT, Lesscher HMB, Giovanetti SM, Messing RO, Shaham Y. Proc Natl Acad Sci U S A. 2020 Apr 7;117(14):8126-8134. doi: 10.1073/pnas.2001615117. Epub 2020 Mar 23. 10.1073/pnas.2001615117 PubMed 32205443