Skip to main content

pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
(Plasmid #135565)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135565 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV SYN1 iRFP-FLAG
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    miR-30 rat SST
  • Alt name
    miRNA vs Firefly somatostatin
  • Species
    R. norvegicus (rat)
  • Promoter SYN1

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nuc-EYFP
  • Alt name
    Yellow Fluorescent protein
  • Insert Size (bp)
    800
  • Promoter hSYN1
  • Tag / Fusion Protein
    • 3xNLS (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST was a gift from Christopher Richie (Addgene plasmid # 135565 ; http://n2t.net/addgene:135565 ; RRID:Addgene_135565)
  • For your References section:

    Abstinence-dependent dissociable central amygdala microcircuits control drug craving. Venniro M, Russell TI, Ramsey LA, Richie CT, Lesscher HMB, Giovanetti SM, Messing RO, Shaham Y. Proc Natl Acad Sci U S A. 2020 Apr 7;117(14):8126-8134. doi: 10.1073/pnas.2001615117. Epub 2020 Mar 23. 10.1073/pnas.2001615117 PubMed 32205443