pOTTC1617 pAAV SYN1 Nuc-EYFP
(Plasmid
#135567)
-
PurposeAn AAV vector expressing a neuronally expressed nuclear EYFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135567 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV SYN1 iRFP-FLAG
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameempty
Gene/Insert 2
-
Gene/Insert nameNuc-EYFP
-
Alt nameYellow Fluorescent protein
-
Insert Size (bp)800
- Promoter hSYN1
-
Tag
/ Fusion Protein
- 3xNLS (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACTCAGCGCTGCCTCAGTCT
- 3′ sequencing primer ATGAAAGCCATACGGGAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1617 pAAV SYN1 Nuc-EYFP was a gift from Christopher Richie (Addgene plasmid # 135567 ; http://n2t.net/addgene:135567 ; RRID:Addgene_135567) -
For your References section:
Abstinence-dependent dissociable central amygdala microcircuits control drug craving. Venniro M, Russell TI, Ramsey LA, Richie CT, Lesscher HMB, Giovanetti SM, Messing RO, Shaham Y. Proc Natl Acad Sci U S A. 2020 Apr 7;117(14):8126-8134. doi: 10.1073/pnas.2001615117. Epub 2020 Mar 23. 10.1073/pnas.2001615117 PubMed 32205443