pSPL3-ABCC8-27
(Plasmid
#135919)
-
PurposeEncodes ABCC8 exon 27 wild type for the analysis of splicing variants
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSPL3
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 6031
- Total vector size (bp) 5423
-
Modifications to backboneWe cut out 943 bp and inserted 353 from ABCC8
-
Vector typeMammalian Expression ; Exon trapping
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP-binding Cassette subfamily C member 8
-
Alt nameABCC8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)351
-
GenBank IDNM_001351296.2
-
Entrez GeneABCC8 (a.k.a. ABC36, HHF1, HI, HRINS, MRP8, PHHI, PNDM3, SUR, SUR1, SUR1delta2, TNDM2)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCGAGAAATTGGCAGAGGATGCCAGA
- 3′ sequencing primer GCTAGCTAATCGGATCGGGGACACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSPL3-ABCC8-27 was a gift from Diana Valverde Pérez (Addgene plasmid # 135919 ; http://n2t.net/addgene:135919 ; RRID:Addgene_135919) -
For your References section:
Characterization of rare ABCC8 variants identified in Spanish pulmonary arterial hypertension patients. Lago-Docampo M, Tenorio J, Hernandez-Gonzalez I, Perez-Olivares C, Escribano-Subias P, Pousada G, Baloira A, Arenas M, Lapunzina P, Valverde D. Sci Rep. 2020 Sep 15;10(1):15135. doi: 10.1038/s41598-020-72089-1. 10.1038/s41598-020-72089-1 PubMed 32934261