Skip to main content

pAF160
(Plasmid #135925)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135925 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAF137 SalI + NheI digest
  • Backbone manufacturer
    Andrew Flies Wild Immunology Laboratory
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TNFRSF9 fused to mAzurite
  • Alt name
    CD137
  • Alt name
    41BB
  • Species
    Tasmanian devil (Sarcophilus harrisii)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mAzurite (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcctcagacagtggttcaaag
  • 3′ sequencing primer aggcacagtcgaggctgat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSBtet_Hyg_60508; pCMV(CAT)T7-SB100_34879; mAzurite from mAzurite-N1_54617

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See bioRxiv preprint: https://doi.org/10.1101/831404 Please see the following article for protocols on how to construct or use this vector: Flies, A. S., Darby, J. M., Murphy, P. R., Pinfold, T. L., Patchett, A. L. & Lennard, P. R. Generation and Testing of Fluorescent Adaptable Simple Theranostic (FAST) Proteins. Bio-protocol under review (2020) https://doi.org/10.21769/BioProtoc.3696.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAF160 was a gift from Andrew S. Flies (Addgene plasmid # 135925 ; http://n2t.net/addgene:135925 ; RRID:Addgene_135925)
  • For your References section:

    A novel system to map protein interactions reveals evolutionarily conserved immune evasion pathways on transmissible cancers. Flies AS, Darby JM, Lennard PR, Murphy PR, Ong CEB, Pinfold TL, De Luca A, Lyons AB, Woods GM, Patchett AL. Sci Adv. 2020 Jul 1;6(27). pii: 6/27/eaba5031. doi: 10.1126/sciadv.aba5031. Print 2020 Jul. 10.1126/sciadv.aba5031 PubMed 32937435