This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3 PARL-FLAG-CT T69D
(Plasmid #13622)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13622 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Presenilin-associated rhomboid-like
  • Alt name
    PARL
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1164
  • Mutation
    changed Thr 69 to Asp
  • GenBank ID
    AF197937
  • Entrez Gene
    PARL (a.k.a. PRO2207, PSARL, PSARL1, PSENIP2, RHBDS1)
  • Entrez Gene
    PARL (a.k.a. PARL)
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GTACGGTGGGAGGTCTATAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 PARL-FLAG-CT T69D was a gift from Luca Pellegrini (Addgene plasmid # 13622 ; http://n2t.net/addgene:13622 ; RRID:Addgene_13622)
  • For your References section:

    Phosphorylation and cleavage of presenilin-associated rhomboid-like protein (PARL) promotes changes in mitochondrial morphology. Jeyaraju DV, Xu L, Letellier MC, Bandaru S, Zunino R, Berg EA, McBride HM, Pellegrini L. Proc Natl Acad Sci U S A. 2006 Dec 5. 103(49):18562-7. 10.1073/pnas.0604983103 PubMed 17116872