gRNA-HEK3-Puro
(Plasmid
#136282)
-
PurposeExpresses a guide RNA targeting HEK3 site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 4838
-
Modifications to backboneCas9-T2A-Puro removed from PX459 from AgeI to EcoR I, Puro inserted back at AgeI and EcoRI. HEK3 protospacer sequence was cloned into the vector according procedure described in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA-HEK3
-
SpeciesSynthetic
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LKO1.5'
- 3′ sequencing primer gtgggcttgtactcggtcat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a plasmid expressing sgRNA targeting HEK3 site. It co-expressed a puromycin resistance gene under the control of Cbh promoter. The vector is modified from pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988) and no longer expresses the Cas9 gene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA-HEK3-Puro was a gift from Zhaohui Ye (Addgene plasmid # 136282 ; http://n2t.net/addgene:136282 ; RRID:Addgene_136282) -
For your References section:
Targeting specificity of APOBEC-based cytosine base editor in human iPSCs determined by whole genome sequencing. McGrath E, Shin H, Zhang L, Phue JN, Wu WW, Shen RF, Jang YY, Revollo J, Ye Z. Nat Commun. 2019 Nov 25;10(1):5353. doi: 10.1038/s41467-019-13342-8. 10.1038/s41467-019-13342-8 PubMed 31767844