pINTO-N3::hTET3 HxD
(Plasmid
#136365)
-
PurposeExpresses epitope-tagged human TET3 catalytically dead (HxD mutation) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepINTO-N3
-
Backbone manufacturerBonasioLab
- Backbone size w/o insert (bp) 6900
- Total vector size (bp) 12300
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTET3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5400
-
MutationHxD (H1077Y, D1079A)
-
GenBank IDNP_001274420.1
-
Entrez GeneTET3 (a.k.a. hCG_40738)
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- HA (N terminal on backbone)
- 2xStrepTagII (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINTO-N3::hTET3 HxD was a gift from Roberto Bonasio (Addgene plasmid # 136365 ; http://n2t.net/addgene:136365 ; RRID:Addgene_136365) -
For your References section:
Delineation of a Human Mendelian Disorder of the DNA Demethylation Machinery: TET3 Deficiency. Beck DB, Petracovici A, He C, Moore HW, Louie RJ, Ansar M, Douzgou S, Sithambaram S, Cottrell T, Santos-Cortez RLP, Prijoles EJ, Bend R, Keren B, Mignot C, Nougues MC, Ounap K, Reimand T, Pajusalu S, Zahid M, Saqib MAN, Buratti J, Seaby EG, McWalter K, Telegrafi A, Baldridge D, Shinawi M, Leal SM, Schaefer GB, Stevenson RE, Banka S, Bonasio R, Fahrner JA. Am J Hum Genet. 2020 Jan 3. pii: S0002-9297(19)30471-9. doi: 10.1016/j.ajhg.2019.12.007. 10.1016/j.ajhg.2019.12.007 PubMed 31928709