Skip to main content

pINTO-N3::hTET3 F1072C
(Plasmid #136366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136366 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pINTO-N3
  • Backbone manufacturer
    BonasioLab
  • Backbone size w/o insert (bp) 6900
  • Total vector size (bp) 12300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TET3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5400
  • Mutation
    F1072C
  • GenBank ID
    NP_001274420.1
  • Entrez Gene
    TET3 (a.k.a. hCG_40738)
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • HA (N terminal on backbone)
    • 2xStrepTagII (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINTO-N3::hTET3 F1072C was a gift from Roberto Bonasio (Addgene plasmid # 136366 ; http://n2t.net/addgene:136366 ; RRID:Addgene_136366)
  • For your References section:

    Delineation of a Human Mendelian Disorder of the DNA Demethylation Machinery: TET3 Deficiency. Beck DB, Petracovici A, He C, Moore HW, Louie RJ, Ansar M, Douzgou S, Sithambaram S, Cottrell T, Santos-Cortez RLP, Prijoles EJ, Bend R, Keren B, Mignot C, Nougues MC, Ounap K, Reimand T, Pajusalu S, Zahid M, Saqib MAN, Buratti J, Seaby EG, McWalter K, Telegrafi A, Baldridge D, Shinawi M, Leal SM, Schaefer GB, Stevenson RE, Banka S, Bonasio R, Fahrner JA. Am J Hum Genet. 2020 Jan 3. pii: S0002-9297(19)30471-9. doi: 10.1016/j.ajhg.2019.12.007. 10.1016/j.ajhg.2019.12.007 PubMed 31928709