-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3-YFP
- Backbone size w/o insert (bp) 6100
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameToll-Like Receptor 10
-
Alt nameTLR10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2477
-
Entrez GeneTLR10 (a.k.a. CD290)
-
Tag
/ Fusion Protein
- YFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Sal I / Xho I (destroyed during cloning)
- 5′ sequencing primer T7
- 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-TLR10-YFP was a gift from Doug Golenbock (Addgene plasmid # 13643 ; http://n2t.net/addgene:13643 ; RRID:Addgene_13643)