Skip to main content

pSico_U6-PLOD2 sgRNA3
(Plasmid #136458)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136458 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSico
  • Backbone size w/o insert (bp) 9580
  • Total vector size (bp) 9600
  • Modifications to backbone
    mKate2-T2A-Bsd cassette included on backbone driven by CAGs promoter
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA against human PLOD2
  • gRNA/shRNA sequence
    TCAGCCGGCGGCCAATAGCC
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    PLOD2 (a.k.a. BRKS2, LH2, TLH)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GATCTACCACATTTGTAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSico_U6-PLOD2 sgRNA3 was a gift from Antonio Amelio (Addgene plasmid # 136458 ; http://n2t.net/addgene:136458 ; RRID:Addgene_136458)
  • For your References section:

    Lysyl hydroxylase 2-induced collagen cross-link switching promotes metastasis in head and neck squamous cell carcinomas. Sato K, Parag-Sharma K, Terajima M, Musicant AM, Murphy RM, Ramsey MR, Hibi H, Yamauchi M, Amelio AL. Neoplasia. 2021 Jun 6;23(6):594-606. doi: 10.1016/j.neo.2021.05.014. 10.1016/j.neo.2021.05.014 PubMed 34107376