Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEN_TTmiRc2_BirA_NRF2
(Plasmid #136524)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136524 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEN_TTmiRc2_BirA
  • Backbone manufacturer
    Addgene #136521
  • Backbone size w/o insert (bp) 4717
  • Modifications to backbone
    This construct does NOT contatin the ccdB gene.
  • Vector type
    entry vector for gateway cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NRF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1815
  • GenBank ID
    NM_006164
  • Entrez Gene
    NFE2L2 (a.k.a. HEBP1, IMDDHH, NRF2, Nrf-2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer TGATAGAGAACGTATGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN_TTmiRc2_BirA_NRF2 was a gift from Kevin Janes (Addgene plasmid # 136524 ; http://n2t.net/addgene:136524 ; RRID:Addgene_136524)
  • For your References section:

    Sporadic activation of an oxidative stress-dependent NRF2-p53 signaling network in breast epithelial spheroids and premalignancies. Pereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA. Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200. 10.1126/scisignal.aba4200 PubMed 32291314