Skip to main content

pEN_TTmiRc2_3xflag_CHEK2
(Plasmid #136526)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136526 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEN_TT miRc2 3xFLAG
  • Backbone manufacturer
    Addgene #83274
  • Backbone size w/o insert (bp) 4496
  • Vector type
    entry vector for gateway cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHEK2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1632
  • GenBank ID
    NM_007194
  • Entrez Gene
    CHEK2 (a.k.a. CDS1, CHK2, HuCds1, LFS2, PP1425, RAD53, TPDS4, hCds1)
  • Tag / Fusion Protein
    • 3x FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer TGATAGAGAACGTATGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN_TTmiRc2_3xflag_CHEK2 was a gift from Kevin Janes (Addgene plasmid # 136526 ; http://n2t.net/addgene:136526 ; RRID:Addgene_136526)
  • For your References section:

    Sporadic activation of an oxidative stress-dependent NRF2-p53 signaling network in breast epithelial spheroids and premalignancies. Pereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA. Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200. 10.1126/scisignal.aba4200 PubMed 32291314