Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQLinkHD
(Plasmid #13668)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-2
  • Backbone manufacturer
    Qiagen
  • Backbone size w/o insert (bp) 4720
  • Vector type
    Bacterial Expression ; Co-Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    DB3.1 from Invitrogen
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gateway cassette
  • Alt name
    pDESTco
  • Insert Size (bp)
    2342
  • GenBank ID
    EF025686
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site attR1 (destroyed during cloning)
  • 3′ cloning site attR2 (destroyed during cloning)
  • 5′ sequencing primer pQE65, TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the chloramphenicol resistance gene outside of the attB sites in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQLinkHD was a gift from Konrad Buessow (Addgene plasmid # 13668 ; http://n2t.net/addgene:13668 ; RRID:Addgene_13668)
  • For your References section:

    Vectors for co-expression of an unrestricted number of proteins. Scheich C, Kummel D, Soumailakakis D, Heinemann U, Bussow K. Nucleic Acids Res. 2007 Feb 20. ():. 10.1093/nar/gkm067 PubMed 17311810