pTet-ctl
(Plasmid
#136693)
-
Purpose(Empty Backbone) Control for pTet-Gli2shR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTet-pLKO-puro (Plasmid #21915)
- Backbone size (bp) 8762
-
Modifications to backboneTet-pLKO-puro (Plasmid #21915) was digested with AgeI and EcoRI and filled-in 5’ overhangs with Klenow DNA polymerase. The resulting pTet-ctl plasmid was confirmed by single digestion with Nco (Expected bands: 3022bp, 5740bp) or XhoI (Expected bands: 8447bp, 190bp, 125bp).
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTet-ctl was a gift from LuZhe Sun (Addgene plasmid # 136693 ; http://n2t.net/addgene:136693 ; RRID:Addgene_136693) -
For your References section:
Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo. Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, Wang B, Sun LZ, Zhu X. Lab Invest. 2018 Nov;98(11):1384-1396. doi: 10.1038/s41374-018-0089-5. Epub 2018 Jul 2. 10.1038/s41374-018-0089-5 PubMed 29967343