pJBL7007
(Plasmid
#136946)
-
PurposeMalachite green aptamer with stability hairpin, bacterial promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136946 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2862
- Total vector size (bp) 3024
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemalachite green aptamer (MGA)
-
SpeciesSynthetic
-
Insert Size (bp)162
- Promoter J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCACGACGTTGTAAAACGAC
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJBL7007 was a gift from Julius Lucks (Addgene plasmid # 136946 ; http://n2t.net/addgene:136946 ; RRID:Addgene_136946) -
For your References section:
Deconstructing Cell-Free Extract Preparation for in Vitro Activation of Transcriptional Genetic Circuitry. Silverman AD, Kelley-Loughnane N, Lucks JB, Jewett MC. ACS Synth Biol. 2019 Feb 15;8(2):403-414. doi: 10.1021/acssynbio.8b00430. Epub 2019 Jan 29. 10.1021/acssynbio.8b00430 PubMed 30596483