pDiySpike1d2
(Plasmid
#136952)
-
PurposePlasmid for the In Vitro transcription of DiySpike1d2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerJoachim Messing
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDiySpike1d2
-
SpeciesSynthetic
-
Insert Size (bp)984
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agcggataacaatttcacacagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDiySpike1d2 was a gift from Rickard Sandberg (Addgene plasmid # 136952 ; http://n2t.net/addgene:136952 ; RRID:Addgene_136952) -
For your References section:
Single-cell RNA counting at allele and isoform resolution using Smart-seq3. Hagemann-Jensen M, Ziegenhain C, Chen P, Ramskold D, Hendriks GJ, Larsson AJM, Faridani OR, Sandberg R. Nat Biotechnol. 2020 Jun;38(6):708-714. doi: 10.1038/s41587-020-0497-0. Epub 2020 May 4. 10.1038/s41587-020-0497-0 PubMed 32518404