pAID6
(Plasmid
#136989)
-
PurposeYeast integration plasmid for expression of dLbCpf1-VP, dSpCas9-RD1152, SaCas9, and Csy4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS41K
-
Backbone manufacturerZhao lab
- Backbone size w/o insert (bp) 4385
- Total vector size (bp) 22541
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedLbCpf1-VP
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4844
- Promoter TDH3
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ctgtaaatctatttcttaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedSpCas9-RD1152
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4803
- Promoter TPI1
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ttcttttcttgcttaaatct (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameSaCas9
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)3264
- Promoter TEF1
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer tcttgctcattagaaagaaagcatag (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameCsy4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)564
- Promoter ENO2
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer gtttctttcataacaccaagca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAID6 was a gift from Huimin Zhao (Addgene plasmid # 136989 ; http://n2t.net/addgene:136989 ; RRID:Addgene_136989) -
For your References section:
Multi-functional genome-wide CRISPR system for high throughput genotype-phenotype mapping. Lian J, Schultz C, Cao M, HamediRad M, Zhao H. Nat Commun. 2019 Dec 19;10(1):5794. doi: 10.1038/s41467-019-13621-4. 10.1038/s41467-019-13621-4 PubMed 31857575