-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOZ-N
- Backbone size w/o insert (bp) 8000
-
Vector typeMammalian Expression
-
Selectable markersIL-2 receptor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHPV 16 E7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)300
-
GenBank IDAY089955
-
Entrez GeneE7 (a.k.a. HpV16gp2)
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACGTGAAGGCTGCCGACCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOZ-N 16 E7 was a gift from Karl Munger (Addgene plasmid # 13706 ; http://n2t.net/addgene:13706 ; RRID:Addgene_13706) -
For your References section:
Association of the human papillomavirus type 16 E7 oncoprotein with the 600-kDa retinoblastoma protein-associated factor, p600. Huh KW, DeMasi J, Ogawa H, Nakatani Y, Howley PM, Munger K. Proc Natl Acad Sci U S A. 2005 Aug 9. 102(32):11492-7. 10.1073/pnas.0505337102 PubMed 16061792