Skip to main content

pAcUW51-CgE
(Plasmid #13762)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 13762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAcUW51
  • Backbone manufacturer
    BD Biosciences
  • Backbone size w/o insert (bp) 5863
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HSV-1 glycoprotein E
  • Alt name
    HSV-1 gE
  • Species
    Herpes simplex virus type I KOS strain
  • Insert Size (bp)
    552
  • Mutation
    C-terminal region of the HSV-1 gE (KOS strain ectodomain) was cloned downstream of the HSV-1 leader peptide by modifying Thr22 to Ala to create an AscI site to fuse the DNA encoding residues 213-390 in frame.
  • Tag / Fusion Protein
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGGACCTTTAATTCAACCCAAC
  • 3′ sequencing primer TTGACACCAGACCAACTGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAcUW51-CgE was a gift from Pamela Bjorkman (Addgene plasmid # 13762 ; http://n2t.net/addgene:13762 ; RRID:Addgene_13762)
  • For your References section:

    Crystal structure of the HSV-1 Fc receptor bound to Fc reveals a mechanism for antibody bipolar bridging. Sprague ER, Wang C, Baker D, Bjorkman PJ. PLoS Biol. 2006 Jun . 4(6):e148. 10.1371/journal.pbio.0040148 PubMed 16646632