pAcUW51-CgE
(Plasmid #13762)

• Depositing Lab: Pamela Bjorkman
• Publication: Sprague et al PLoS Biol. 2006 Jun . 4(6):e148.

Backbone

• Vector backbone: pAcUW51
• Backbone manufacturer: BD Biosciences
• Backbone size w/o insert (bp): 5863
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HSV-1 glycoprotein E
• Alt name: HSV-1 gE
• Species: Herpes simplex virus type I KOS strain
• Insert Size (bp): 552
• Mutation: C-terminal region of the HSV-1 gE (KOS strain ectodomain) was cloned downstream of the HSV-1 leader peptide by modifying Thr22 to Ala to create an AscI site to fuse the DNA encoding residues 213-390 in frame.
• Tag / Fusion Protein:
  • His (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGGACCTTTAATTCAACCCAAC
• 3′ sequencing primer: TTGACACCAGACCAACTGGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry