FKBP-CD28TMD-NTEVp(H75E)
(Plasmid
#137829)
-
PurposeMESA split-TEV protease chain with FKBP Rapamycin ectodomain, CD28 transmembrane domain, N-terminal H75E mutant TEV protease
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1/HygroR(+)
- Backbone size w/o insert (bp) 4318
- Total vector size (bp) 5413
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP-CD28TMD-NTEVp(H75E)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1095
-
MutationMutated Histidine 75 to Glutamic Acid in NTEVp fragment
- Promoter CMV
-
Tag
/ Fusion Protein
- 3x FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/863530v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FKBP-CD28TMD-NTEVp(H75E) was a gift from Joshua Leonard (Addgene plasmid # 137829 ; http://n2t.net/addgene:137829 ; RRID:Addgene_137829) -
For your References section:
Computation-guided optimization of split protein systems. Dolberg TB, Meger AT, Boucher JD, Corcoran WK, Schauer EE, Prybutok AN, Raman S, Leonard JN. Nat Chem Biol. 2021 May;17(5):531-539. doi: 10.1038/s41589-020-00729-8. Epub 2021 Feb 1. 10.1038/s41589-020-00729-8 PubMed 33526893