Skip to main content

FKBP-NTEVp(WT)
(Plasmid #137831)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137831 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1/HygroR(+)
  • Backbone size w/o insert (bp) 4321
  • Total vector size (bp) 5173
  • Modifications to backbone
    Modified from pcDNA3.1/HygroR(+) to lack HygroR.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP-NTEVp(WT)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    852
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3x FLAG (N terminal on insert)
    • NES (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/863530v2 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FKBP-NTEVp(WT) was a gift from Joshua Leonard (Addgene plasmid # 137831 ; http://n2t.net/addgene:137831 ; RRID:Addgene_137831)
  • For your References section:

    Computation-guided optimization of split protein systems. Dolberg TB, Meger AT, Boucher JD, Corcoran WK, Schauer EE, Prybutok AN, Raman S, Leonard JN. Nat Chem Biol. 2021 May;17(5):531-539. doi: 10.1038/s41589-020-00729-8. Epub 2021 Feb 1. 10.1038/s41589-020-00729-8 PubMed 33526893