pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
(Plasmid
#138295)
-
PurposegRNA for CRISPR/Cas9 knockout of human TRIM21
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSpCas9 wt (pSpCAS9(BB)-2A-GFP)
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
- Backbone size w/o insert (bp) 9300
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA TRIM21
-
Alt nameE3 ubiquitin-protein ligase TRIM21
-
gRNA/shRNA sequenceGAAACACCGTGACCACGCCA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneTRIM21 (a.k.a. RNF81, RO52, Ro/SSA, SSA, SSA1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer U6 promoter forward: GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21 was a gift from Gaudenz Danuser (Addgene plasmid # 138295 ; http://n2t.net/addgene:138295 ; RRID:Addgene_138295) -
For your References section:
Mechanical regulation of glycolysis via cytoskeleton architecture. Park JS, Burckhardt CJ, Lazcano R, Solis LM, Isogai T, Li L, Chen CS, Gao B, Minna JD, Bachoo R, DeBerardinis RJ, Danuser G. Nature. 2020 Feb 12. pii: 10.1038/s41586-020-1998-1. doi: 10.1038/s41586-020-1998-1. 10.1038/s41586-020-1998-1 PubMed 32051585