pMtb MCM
(Plasmid
#138296)
-
PurposeExpression of Mtb MCM small and large subunit
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETduet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 9520
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemutA
-
Alt nameRv1492
-
SpeciesM. tuberculosis
-
Insert Size (bp)1893
-
Mutationinserted TEV cleavage site between His-tag and mutA
-
GenBank IDNP_216008.1 NP_216008.1
- Promoter T7
-
Tags
/ Fusion Proteins
- His tag (N terminal on backbone)
- TEV cleavage site
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ttgtacacggccgcataatc
- 3′ sequencing primer gattatgcggccgtgtacaa
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemutB
-
Alt nameRv1493
-
SpeciesM. tuberculosis
-
Insert Size (bp)2253
-
GenBank IDNP_216009.1 NP_216009.1
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer ttgtacacggccgcataatc
- 3′ sequencing primer T7 terminal
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMtb MCM was a gift from Ruma Banerjee (Addgene plasmid # 138296 ; http://n2t.net/addgene:138296 ; RRID:Addgene_138296) -
For your References section:
Itaconyl-CoA forms a stable biradical in methylmalonyl-CoA mutase and derails its activity and repair. Ruetz M, Campanello GC, Purchal M, Shen H, McDevitt L, Gouda H, Wakabayashi S, Zhu J, Rubin EJ, Warncke K, Mootha VK, Koutmos M, Banerjee R. Science. 2019 Nov 1;366(6465):589-593. doi: 10.1126/science.aay0934. 10.1126/science.aay0934 PubMed 31672889