pMtb CblA
(Plasmid
#138298)
-
PurposeExpression of Mtb CblA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepet28b
-
Backbone manufacturerEMD millipore
- Backbone size w/o insert (bp) 5368
- Total vector size (bp) 6370
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMtb CblA
-
Alt nameRv1496
-
Alt nameProbably GTPase Rv1496
-
SpeciesM. tuberculosis
-
Insert Size (bp)1005
-
GenBank IDNP_216012.1 NP_216012.1
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMtb CblA was a gift from Ruma Banerjee (Addgene plasmid # 138298 ; http://n2t.net/addgene:138298 ; RRID:Addgene_138298) -
For your References section:
Itaconyl-CoA forms a stable biradical in methylmalonyl-CoA mutase and derails its activity and repair. Ruetz M, Campanello GC, Purchal M, Shen H, McDevitt L, Gouda H, Wakabayashi S, Zhu J, Rubin EJ, Warncke K, Mootha VK, Koutmos M, Banerjee R. Science. 2019 Nov 1;366(6465):589-593. doi: 10.1126/science.aay0934. 10.1126/science.aay0934 PubMed 31672889