pAJ1
(Plasmid
#138379)
-
PurposepEcRNAP6 derivative encoding Escherichia coli core RNA polymerase subunits: RpoA, RpoB, RpoC(His)10, RpoZ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21a
- Backbone size w/o insert (bp) 15815
- Total vector size (bp) 5000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameRpoA
-
SpeciesE. coli
-
Insert Size (bp)990
-
GenBank ID947794
-
Entrez GenerpoA (a.k.a. b3295, ECK3282, pez, phs, sez)
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer T7
- 3′ sequencing primer cgctgacaagtccacggatcggggatccgg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRpoB
-
SpeciesE. coli
-
Insert Size (bp)4029
-
GenBank ID948488
-
Entrez GenerpoB (a.k.a. b3987, ECK3978, ftsR, groN, nitB, rif, ron, sdgB, stl, stv, tabD)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ccgtcgacttgtcagcgagctgaggaaccc
- 3′ sequencing primer ggttttaacccgacagcagtgacctgtttgagcg
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRpoC
-
Alt nameRpoC dCT
-
SpeciesE. coli
-
Insert Size (bp)4185
-
MutationClamp toe deletion: Δ(Tyr144-Lys179) ::(G144-S145). PreScission protease site (GE Healthcare; LEVLFQGP) is inserted between the C-terminus of RpoC and the (His)10-tag
-
GenBank ID948487
-
Entrez GenerpoC (a.k.a. b3988, ECK3979, tabB)
-
Tag
/ Fusion Protein
- His10 (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer gcggattgtgctaactccgacgggagcaaatcc
- 3′ sequencing primer gcttattttgagtggactattgaggccagag
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namerpoZ
-
SpeciesE. coli
-
Insert Size (bp)276
-
GenBank ID948160
-
Entrez GenerpoZ (a.k.a. b3649, ECK3639, spoS)
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer gcttcaatgactgcagacttaagaaggagattaatg
- 3′ sequencing primer ccccgaaaagtgccacctgacgtagttatccg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypEcRNAP6, Twist KA, Husnain SI, Franke JD, Jain D, Campbell EA, Nickels BE, Thomas MS, Darst SA, Westblade LF
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A novel method for the production of in vivo-assembled, recombinant Escherichia coli RNA polymerase lacking the alpha C-terminal domain.2
Twist KA, Husnain SI, Franke JD, Jain D, Campbell EA, Nickels BE, Thomas MS, Darst SA, Westblade LF
Protein Sci. 2011 Jun;20(6):986-95. doi: 10.1002/pro.622. Epub 2011 Apr 26.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAJ1 was a gift from Seth Darst (Addgene plasmid # 138379 ; http://n2t.net/addgene:138379 ; RRID:Addgene_138379) -
For your References section:
Structural basis for transcription activation by Crl through tethering of sigma(S) and RNA polymerase. Cartagena AJ, Banta AB, Sathyan N, Ross W, Gourse RL, Campbell EA, Darst SA. Proc Natl Acad Sci U S A. 2019 Sep 17;116(38):18923-18927. doi: 10.1073/pnas.1910827116. Epub 2019 Sep 4. 10.1073/pnas.1910827116 PubMed 31484766