Skip to main content

pET-Himar-dCas9-mammalian
(Plasmid #138414)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138414 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5647
  • Total vector size (bp) 10969
  • Modifications to backbone
    removed N-terminal 6xHis tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The bacterial strain BL21 DE3 or Rosetta 2 DE3 is preferred for downstream applications.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Himar-dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    5322
  • Promoter T7
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • SV40 NLS (N terminal on insert)
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATATAGGCGCCAGCAACCGCACCT
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Himar-dCas9-mammalian was a gift from Harris Wang (Addgene plasmid # 138414 ; http://n2t.net/addgene:138414 ; RRID:Addgene_138414)
  • For your References section:

    An Engineered Cas-Transposon System for Programmable and Site-Directed DNA Transpositions. Chen SP, Wang HH. CRISPR J. 2019 Dec;2(6):376-394. doi: 10.1089/crispr.2019.0030. Epub 2019 Nov 19. 10.1089/crispr.2019.0030 PubMed 31742433