pHdCas9-mammalian
(Plasmid
#138415)
-
PurposeExpression of Himar-dCas9 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFokI-dCas9 (Addgene 52970)
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 8727
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHimar-dCas9
-
SpeciesSynthetic
-
Insert Size (bp)5196
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on backbone)
- SV40 NLS (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHdCas9-mammalian was a gift from Harris Wang (Addgene plasmid # 138415 ; http://n2t.net/addgene:138415 ; RRID:Addgene_138415) -
For your References section:
An Engineered Cas-Transposon System for Programmable and Site-Directed DNA Transpositions. Chen SP, Wang HH. CRISPR J. 2019 Dec;2(6):376-394. doi: 10.1089/crispr.2019.0030. Epub 2019 Nov 19. 10.1089/crispr.2019.0030 PubMed 31742433