pcDNA4/TO-BcRF1 1-203-2xStrep
(Plasmid
#138449)
-
PurposeExpresses truncated BcRF1 with a C-terminal 2xStrep tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5118
- Total vector size (bp) 5730
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBcRF1
-
SpeciesEBV (HHV-4)
-
Insert Size (bp)609
-
MutationAmino acids 1-203
-
Entrez GeneBcRF1 (a.k.a. HHV4_BcRF1.2)
- Promoter CMV
-
Tag
/ Fusion Protein
- Strep (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO-BcRF1 1-203-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 138449 ; http://n2t.net/addgene:138449 ; RRID:Addgene_138449) -
For your References section:
The gammaherpesviral TATA-box-binding protein directly interacts with the CTD of host RNA Pol II to direct late gene transcription. Castaneda AF, Didychuk AL, Louder RK, McCollum CO, Davis ZH, Nogales E, Glaunsinger BA. PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep. 10.1371/journal.ppat.1008843 PubMed 32886723