pQLink-GST-10xCTD
(Plasmid #138472)

• Purpose: Expresses GST-tagged 10xCTD heptapeptide repeat in bacteria
• Depositing Lab: Britt Glaunsinger
• Publication: Castaneda et al PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep.

Backbone

• Vector backbone: pQLinkG2
• Backbone size w/o insert (bp): 5519
• Total vector size (bp): 5729
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rpb1
• Species: H. sapiens (human)
• Insert Size (bp): 210
• Mutation: 10x CTD repeat
• Entrez Gene: POLR2A (a.k.a. NEDHIB, POLR2, POLRA, RPB1, RPBh1, RPO2, RPOL2, RpIILS, hRPB220, hsRPB1)
• Promoter: T5
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry