Skip to main content

PL-5LTR-RGR(DMD​#​1​)-AmCyan-A
(Plasmid #138482)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 138482 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PL-sin vector
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6286
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ribozyme-flanked gRNA and AmCyan
  • Species
    Synthetic
  • Insert Size (bp)
    1060

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGGTGATGATTGTGTGGCAAG
  • 3′ sequencing primer TGAAGGTGGAGGTCTGGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PL-5LTR-RGR(DMD​#​1​)-AmCyan-A was a gift from Akitsu Hotta (Addgene plasmid # 138482 ; http://n2t.net/addgene:138482 ; RRID:Addgene_138482)
  • For your References section:

    Extracellular nanovesicles for packaging of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping. Gee P, Lung MSY, Okuzaki Y, Sasakawa N, Iguchi T, Makita Y, Hozumi H, Miura Y, Yang LF, Iwasaki M, Wang XH, Waller MA, Shirai N, Abe YO, Fujita Y, Watanabe K, Kagita A, Iwabuchi KA, Yasuda M, Xu H, Noda T, Komano J, Sakurai H, Inukai N, Hotta A. Nat Commun. 2020 Mar 13;11(1):1334. doi: 10.1038/s41467-020-14957-y. 10.1038/s41467-020-14957-y PubMed 32170079