-
PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138482 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePL-sin vector
- Backbone size w/o insert (bp) 5200
- Total vector size (bp) 6286
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRibozyme-flanked gRNA and AmCyan
-
SpeciesSynthetic
-
Insert Size (bp)1060
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGGTGATGATTGTGTGGCAAG
- 3′ sequencing primer TGAAGGTGGAGGTCTGGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PL-5LTR-RGR(DMD#1)-AmCyan-A was a gift from Akitsu Hotta (Addgene plasmid # 138482 ; http://n2t.net/addgene:138482 ; RRID:Addgene_138482) -
For your References section:
Extracellular nanovesicles for packaging of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping. Gee P, Lung MSY, Okuzaki Y, Sasakawa N, Iguchi T, Makita Y, Hozumi H, Miura Y, Yang LF, Iwasaki M, Wang XH, Waller MA, Shirai N, Abe YO, Fujita Y, Watanabe K, Kagita A, Iwabuchi KA, Yasuda M, Xu H, Noda T, Komano J, Sakurai H, Inukai N, Hotta A. Nat Commun. 2020 Mar 13;11(1):1334. doi: 10.1038/s41467-020-14957-y. 10.1038/s41467-020-14957-y PubMed 32170079