pGEX4T1-Rpb4/7
(Plasmid #138484)

• Purpose: Expresses GST-tagged Rpb4 and His-tagged Rpb7 in bacteria
• Depositing Lab: Britt Glaunsinger
• Publication: Castaneda et al PLoS Pathog. 2020 Sep 4;16(9):e1008843. doi: 10.1371/journal.ppat.1008843. eCollection 2020 Sep.

Backbone

• Vector backbone: pGEX-4T-1
• Backbone manufacturer: GE Healthcare
• Backbone size w/o insert (bp): 4946
• Total vector size (bp): 5941
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Rpb4
• Species: H. sapiens (human)
• Insert Size (bp): 429
• Entrez Gene: POLR2D (a.k.a. HSRBP4, HSRPB4, RBP4, RPB16, RPB4)
• Promoter: tac
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Gene/Insert 2

• Gene/Insert name: Rpb7
• Species: H. sapiens (human)
• Insert Size (bp): 516
• Entrez Gene: POLR2G (a.k.a. RPB19, RPB7, hRPB19, hsRPB7)
• Promoter: tac
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: CCGGGAGCTGCATGTGTCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry