pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract
(Plasmid
#138524)
-
PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt PRC2-binding G-tract repeat RNA sequence.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1-puro U6 sgRNA BfuA1 stuffer
- Backbone size w/o insert (bp) 7145
- Total vector size (bp) 7423
-
Modifications to backboneInsertion of a spacer and G-tract repeat RNA sequence
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRC2-binding G-tract repeat RNA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
- 3′ sequencing primer CCTCGAGCCGCGGCCAAAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract was a gift from Richard Jenner (Addgene plasmid # 138524 ; http://n2t.net/addgene:138524 ; RRID:Addgene_138524) -
For your References section:
G-tract RNA removes Polycomb repressive complex 2 from genes. Beltran M, Tavares M, Justin N, Khandelwal G, Ambrose J, Foster BM, Worlock KB, Tvardovskiy A, Kunzelmann S, Herrero J, Bartke T, Gamblin SJ, Wilson JR, Jenner RG. Nat Struct Mol Biol. 2019 Oct;26(10):899-909. doi: 10.1038/s41594-019-0293-z. Epub 2019 Sep 23. 10.1038/s41594-019-0293-z PubMed 31548724